Expression, Localisation and Functional Activation of NFAT 4 in Human Skin, Cultured Keratinocytes and Cultured Fibroblasts
Dr Wael. I. Al-Daraji *
*Correspondence to: Dr Wael. I. Al-Daraji, MBBS, MSc, Dip GUM & HIV medicine, MRCP, Dip Inf Dis, DHMSA, MD.
Copyright
© 2025 Dr Wael. I. Al-Daraji. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Received: 02 January 2025
Published: 21 January 2025
DOI: https://doi.org/10.5281/zenodo.14709366
Abstract:
Background: Ciclosporin A (CsA) is widely utilized for the treatment of inflammatory skin diseases such as psoriasis. The therapeutic effects of CsA are thought to be mediated via its immunosuppressive action on infiltrating lymphocytes in skin lesions. CsA and tacrolimus block T cell activation by inhibiting the phosphatase calcineurin and preventing translocation from the cytoplasm to the nucleus of the transcription factor Nuclear Factor of Activated T cells (NFAT). NFAT compose a family of transcription factors that are turned on during T cell activation. The NFAT family is composed of five members: NFAT 1, NFAT 2, NFAT 3, NFAT 4 and the recently isolated NFAT 5.
Aims: As calcineurin and NFAT 1 have been shown to be functionally active in cultured human keratinocytes, expression of other NFAT family members such as NFAT 4 and possible functional activation was investigated in human keratinocytes and dermal fibroblasts.
Methods: RT-PCR and Western Analysis were used to investigate the presence of NFAT 4 mRNA and protein. Tissue culture of human keratinocytes and human fibroblasts, immunostaining of cells on coverslips and confocal microscopy were used to assess the degree of nuclear localisation of NFAT 4 in cultured cells. Keratome biopsies were taken from patients with psoriasis (lesional and non-lesional skin) and normal skin and immunohistochemistry was used to assess the NFAT 4 localisation in these biopsies in vivo using a well characterized anti-NFAT 4 antibody.
Results: The NFAT 4 mRNA and protein expression was demonstrated using RT-PCT and Western blotting. The expression of NFAT 4 in vivo in normal skin, non-lesional and lesional psoriasis was also investigated. A range of cell types in the skin express NFAT 2.
For example, three members of NFAT (NFAT 1, NFAT 2 and NFAT 4) were shown to be present in the cytoplasm of human muscle cells at all stages of myogenesis. However, in cultured human skeletal muscle cells each NFAT undergoes nuclear translocation at a different stage of myogenesis, suggesting that each NFAT may regulate different subsets of genes necessary for muscle cell physiology. Therefore, expression of NFAT 4 in human keratinocytes and dermal fibroblasts and response to different agonists provides perhaps a unique opportunity to examine the regulation, subcellular localization and kinetics of translocation of different NFATs in primary cultured human cells.
In these experiments the author assessed the expression, localization of NFAT 2 in cultured human keratinocytes and dermal fibroblasts and measured the degree of nuclear localisaion of NFAT 4 using immunoflourescence and confocal microscopy and whether CsA and tacrolimus inhibits NFAT 4 nuclear translocation. As with NFAT 1, differentiation-promoting agents that increase intracellular calcium concentration induced nuclear translocation of NFAT 4 in cultured keratinocytes but with different kinetics. On the other hand, human dermal fibroblasts expressed NFAT 2 showing different effects to different agonists.
Conclusion: These data provide the first evidence of that NFAT 4 is expressed in normal skin, psoriasis and that NFAT 4 functionally active in human keratinocytes and dermal fibroblasts and that nuclear translocation of NFAT 4 in human skin cells has different kinetics than NFAT 1 suggesting that NFAT 4 may play an important role in regulation of keratinocytes proliferation and differentiation at a different stage. Inhibition of this pathway in human epidermal keratinocytes many account, in part for the therapeutic effects of CsA and tacrolimus in skin disorders such as psoriasis. Thus, supporting our previous work data that calcineurin/NFAT is functionally active not only in T cells, but in skin cells.
Key words: Human keratinocytes, dermal fibroblasts, intracellular calcium, psoriasis, NFAT 4, signal transduction
Introduction
Psoriasis is a common skin condition characterized by hyperproliferative epidermis, abnormal keratinocyte differentiation and inflammation. CsA and tacrolimus are effective treatments for psoriasis. IL-2 production in T cells depends on activation of phosphatase calcineurin and translocation of the transcription factor NFAT to the nucleus. CsA and tacrolimus block T cell activation by inhibiting this pathway (Figure 1).
Figure 1
T cells are known to play an important role in the pathogenesis of psoriasis. However, a number of lines of evidence indicate that CsA exerts direct effects in skin, which are independent of its action on T cells. Although CsA and tacrolimus are immunosuppressive drugs that inhibit T cell activation, it is possible that these drugs may work in part through direct action on the skin, independent of their action on T-cells. A number of lines of evidence indicate direct effects of CsA on epidermal keratinocytes. However, the results obtained so far are contradictory. Several in vitro studies have reported a direct antiproliferative effect of CsA in cultures of proliferating epidermal keratinocytes (1-4). For example, CsA inhibits the proliferation of keratinocytes and fibroblasts in culture at concentrations (1-10 mg/ml) that have been in psoriatic plaques following the systemic administration of CsA (4-6). In addition, CsA and tacrolimus both induce hair growth (7-9) and topical tacrolimus stimulates hair growth in SCID mice (7). CsA also inhibits antigen presentation by Langerhans cells (10) and inhibits neutrophil chemotaxis (11). Urabe et al. (1989) reported direct in vivo antiproliferative effect of CsA on human epidermal keratinocytes grafted on to nude mice (12). Gschwendt et al. (1985, 1986, and 1987) demonstrated that CsA inhibits the induction of DNA synthesis, ornithine decarboxylase, alkaline phosphate activity, and 8-hydroxyeicosaterenoic acid in mouse epidermis, following topical application of the tumour-promoting phorbol ester 12-O-tetradecanoyl-phorbol-13-acetate (TPA) (13-15). CsA was demonstrated to inhibit TPA-induced inflammatory hyperplastic response (16). In this study, inhibition of ornithine decarboxylase induction (a proliferation marker) and inhibition of membrane-associated transglutaminase activity (a terminal differentiation marker) were observed in the skin of hairless mice (16). CsA also inhibits TPA induced-cutaneous inflammation in severe combined immunodeficient mice that lack functional lymphocytes (17).
However, Gottlieb et al. (1992) found that the predominant direct mechanism of action of CsA in vivo is a diminution of T cell activation, in biopsies from psoriatic plaques, with attendant decreased cytokine production. In addition, keratinocyte growth activation was less sensitive to the inhibitory effects of CsA (18). Furthermore, another study failed to show inhibition of epidermal growth in pig skin explant cultures by CsA at therapeutic levels (19). More research to clarify the effects of CsA on skin cells is obviously needed. We have previously shown that treatment of cultured human keratinocytes with agents that induce a sustained rise in intracellular calcium, including elevation of extracellular calcium ((20) leads to nuclear translocation of endogenous NFAT 1, which was inhibited by pre-treatment with CsA, tacrolimus(21, 22) and recently with nifedipine(23).
NFAT is known to be expressed in other cells and organs such as skin. Mouse skin tumours have been shown to express NFAT 1 mRNA (24). Verweij et al. (1990) using an oligomerized NFAT 1 binding motif that directed SV40 T-antigen expression in transgenic mice found constitutive expression only in skin. Using immunofluorescence, they reported T antigen positive cells within the dermis (25), although expression within the epidermis is also evident. Nishio et al. (2000) have also recently reported immunolocalizsation of calcineurin and FKBP12 in human epidermis using immunohistochemical methods (26). Furthermore, recent evidence indicates that UV radiation is a strong inducer of NFAT activation in mouse epidermal cells and skin (27). Santini et al. (2001) have shown that calcineurin regulates the expression of mouse keratinocyte differentiation markers and the cyclin-dependent kinase inhibitor p21WAF1 through a mechanism that appears to involve an interaction between NFAT1/NFAT2 and the Sp1/Sp3 transcription factors (28). In addition, this study showed that treatment of primary mouse keratinocytes with CsA suppressed the expression of terminal keratinocyte differentiation markers (28).
The four different NFAT proteins, their overlapping expression patterns, and the relatively mild phenotypes of mutant mice lacking single NFAT, suggest that they might be functionally redundant (29, 30). Therefore, double mutant mice were used to explore this issue. In fact, mice deficient in both NFAT 1 and NFAT 4 demonstrated more profound lymphadenopathy and increased Th2 responses (31). The striking allergic phenotype with allergic blepharitis and interstitial pneumonitis suggests a role for NFAT 1 and NFAT 4 in suppressing the production of allergic responsible cytokines (31).In contrast, T cells deficient in both NFAT 1 and NFAT 2 were incompetent in producing Th1 and Th2 cytokines, while B cells were paradoxically hyperactive, suggesting a role for NFAT in suppressing B cell responses (32).
In lymphocytes, calcium entry regulates calcineurin activity that dephosphorylates NFAT family member unmasking the nuclear localization sequence resulting in nuclear translocation of NFAT (33, 34). Lymphocytes express NFAT 1, NFAT 2 and NFAT 4 (35) and each NFAT member translocates to the nucleus with the same kinetics in response to TPA plus ionomycin (30). Together with the relatively mild phenotypes of mutant mice lacking single NFAT, suggested that NFAT family members might be functionally redundant (29, 30). Three members of NFAT (NFAT 1, NFAT 2 and NFAT 4) were shown to be present in the cytoplasm of human muscle cells at all stages of myogenesis. However, in cultured human skeletal muscle cells each NFAT undergoes nuclear translocation at a different stage of myogenesis, suggesting that each NFAT may regulate different subsets of genes necessary for muscle cell physiology (36). In T cells and mast cells NFAT activation is mediated by calcium signals emerging from their respective antigen receptors, TCR (37) and Fc?RI respectively (38). The relevant receptors and signalling pathways that activate NFAT in other cell types have not been well studied.
As calcineurin and NFAT 1 have been shown to be functionally active in cultured human keratinocytes(21), expression of other NFAT family members and possible functional activation was investigated in human keratinocytes and dermal fibroblasts. Santini et al. (2001) showed that NFAT 1 and NFAT 2 associate with another transcription factor (Sp1) in mouse keratinocytes in a calcineurin dependent-pattern (28). The expression of NFAT 4 in human keratinocytes and dermal fibroblasts provides perhaps a unique opportunity to examine the regulation, subcellular localization and kinetics of translocation in primary cultured human cells. To determine whether nuclear translocation of NFAT 3 take place with the same kinetics in cultured keratinocytes and dermal fibroblasts, subcellular localization of these transcription factors were investigated using immunofluorescence techniques and confocal microscopy.
Materials and Methods
Material:
Ciclosporin A (CsA) and tacrolimus
CsA and tacrolimus were provided by Novartis Pharma AG, (Basle, Switzerland) and Fujisawa Pharmaceutical Co (Osaka, Japan), respectively. Tacrolimus was also obtained from Affinity Research Products Ltd (Exeter, UK).
Cell culture materials
Keratinocytes growth medium (MCDB 153) and trypsin/ethylenediamine tetra-acetic acid (EDTA) were purchased from Sigma laboratories (Poole, UK). Dulbecco’s Modified Eagle’s Medium (DMEM), RPMI 1640 medium and foetal calf serum (FCS) were from Gibco BRL Life Technologies (Paisley, UK).
Primers
NFAT 4 primers were synthesized by MWG-Biotech AG (Ebersberg, Germany).
Keratinocytes differentiation agents and growth factors
TPA, ionomycin, Transforming factor β TGF-b, Retinoic Acid (RA) and Dimethyl Sulphoxide (DMSO) (vehicle control) were obtained from Sigma (Poole, UK).
Materials used in Western analysis
Precast polyacrylamide gels were purchased from Invitrogen (Paisley, UK). Hybond enhanced chemiluminescence (ECL) nitrocellulose membranes, ECL molecular weight markers were obtained from Amersham (Buckinghamshire, UK). Prestained protein standards were provided by Bio-Rad Laboratories Ltd (Herts, UK). Anti-NFAT 4 dilution was 1:7500
Antibodies
Anti-NFAT 4 (1689) was kindly made available by Dr Nancy Rice, NCI-Frederick Cancer Research and Developmental Centre, Maryland, USA. This antibody has been previously characterized (35).
Tissue culture
The general tissue culture methods used followed those described by Freshney (39).
1. Culture medium MCDB153
The culture medium used for growing keratinocytes was the serum-free medium MCDB153 described by Boyce and Ham (40), with modifications described by Wille and Pittelkow (41, 42). Powdered MCDB153 medium was obtained from Sigma with a calcium concentration of 70 µmol/L, supplemented with ethanolamine (6.1µl/L), phosphoethanolamine (14µg/ml), hydrocortisone (0.18µg/ml), insulin (5 µg/ml), transferrin (5µg/ml), epidermal growth factor (10ng/ml), and amino acids (42). The medium obtained is referred to as complete MCDB153. Media were filter sterilised through a 0.2µm filter (Millipore), and stored at 4°C for up to two months before use. Antibiotics were added to give a final concentration of penicillin G (5 IU/ml) and streptomycin (5 µg/ml) (Sigma; Poole, UK).
2 Collection of Biopsy Samples
Fresh human skin tissue to start each cell line, at least 2-3 cm², was obtained mainly from two elective surgical procedures as described (43).
• Paediatric circumcision, usually undertaken at the age of 2-5 years.
• Retro-aural skin excised during reduction of Bat Ears, usually undertaken at the age of 8-15 years. This provided one to three ellipses of skin measuring 2-3 by 4-6 cm.
After removal, skin was placed in “transport medium”. Universal vials containing 10ml DMEM with 5 IU/ml penicillin G, 5µg/ml streptomycin (ICN Biochemicals; Hampshire, UK) and 240 units/ml nystatin, were supplied to the surgical theatres (Royal Victoria Infirmary; Newcastle upon Tyne, UK). Samples were collected as soon as possible after excision (i.e. immediately after telecommunication from theatre staff) or stored at 4°C. Tissue was kept at 4°C, processed the same day or the following morning, and used for different applications or snap frozen in liquid nitrogen and stored at –80°C until required.
3 Separation of Epidermis from Dermis by Treatment with Dispase
The tissue was trimmed of fat and excess dermis using curved scissors, washed in sterile phosphate buffered saline (PBS), 70:30 ethanol/water (v/v) for 30-60 sec and finally in PBS. The skin was placed epidermis down and cut into small squares 2-3mm by 2-3mm (foreskin) or rectangular pieces 2-4 mm by 10 mm (retro-aural skin). Thus, subsequent removal of the epidermis was made easier. The mucosal surface of foreskin specimens was not used. Normal skin biopsy samples were rinsed in Ca2+ and Mg2+ free PBS containing 5 IU/ml penicillin G and 5µg/ml streptomycin. Protease digestion of skin leads to separation of the epidermis from the dermis (39). Epidermis was separated from dermis after overnight incubation at 4°C in Dispase II (neutral protease) (Boehinger Mannheim; Sussex, UK).
4 Culture of primary human keratinocytes
The epidermis was gently and carefully separated with fine forceps. The epidermis of retro-aural skin was thick enough to be removed in a single piece from the skin strips, but for foreskin epidermis, which is more friable, several small squares of skin were used. The epidermis was incubated for 5-10 min at 37°C with trypsin (0.05%) and EDTA (0.02%) and shaken manually in a sealed tube to disaggregate the basal keratinocytes. Trypsin was removed by washing in Ca2+ and Mg2+-free PBS with centrifugation (2500 RPM, 5 min), cells resuspended in MCDB153 medium and an aliquot counted by the trypan blue dye exclusion method using a Niebaur counting chamber (39). Keratinocytes were cultured in a serum-free medium MCDB153 (42). Cells were plated on to plastic flasks (Costar and Corning; Netherlands) in serum-free medium MCDB153 at a density of approximately 3x104/cm². Keratinocytes were expanded by serial passage and used for experiments between passages 2 and 3.
5 Culture of dermal fibroblasts
Human fibroblasts were established by explant culture from the dermal portion of skin specimens. Flasks were scored with a scalpel blade and small portions of dermis (3-4mm) with a small amount of medium (to prevent the tissue from floating). When the dermis had attached, medium was added and the flasks were returned to the incubator at 37°C for 2-3 days. Fibroblasts which grew out from the explanted dermis were passaged and grown in DMEM with 10% FCS. Antibiotics were added to a final concentration of penicillin G (5 IU/ml) and streptomycin (5 µg/ml). Fibroblasts were removed from flasks by incubation with trypsin (0.05%) and EDTA (0.02%) at 37°C for 10-20 min followed by gentle agitation. Fibroblasts were expanded by serial passage and used for experiments between passages 3 and 6.
6 Culture of Jurkat T cells
Jurkat T cells (44-46), a kind gift from Dr A Hall (Cancer research centre, Newcastle upon Tyne, UK), were cultured in RPMI 1640 medium with 10% FCS. Cells were incubated at 37°C with 5% CO2. RNA was extracted from Jurkat T cells in passage 4-5.
Imunofluorescence staining of cultured cells:
Coverslips preparations
Cells were trypsinized from flasks and seeded onto sterile coverslips placed in twelve well plates, so that there were 3x104 cells on each coverslip. Coverslips were incubated in an incubator at 37°C in 5% CO2. Coverslips were prepared as described (21, 47).
Keratinocytes or fibroblasts were treated with specific agents, DMSO (1:1000) (vehicle control), or switched to medium containing raised extracellular calcium (1.5 mM CaCl2) 15 min and 18 h. Some coverslip cultures were pre-treated with CsA or tacrolimus for 1 h. After the time of incubations, the medium was aspirated and the cells were washed three times in Ca2+ and Mg2+ -free ice cold PBS before being fixed.
Fixation method
The effects of permeabilization and fixation conditions on the subcellular localization of antigens (48) was examined carefully. Fixation methods fall generally into two categories, organic solvents and cross-linking reagents. The optimal fixation method was chosen empirically (49) and fixation in organic solvents and cross-linking agents was studied. The protocol utilised included 0.7% paraformaldehyde with 0.2% Triton X-100 and 4% paraformaldehyde as cross-linking agents. Acetone or 50% acetone/ 50% methanol for 10 min at room temperature were used as organic solvents. Cells fixed in 4% paraformaldehyde for 10 min were then permeabilised with 0.2% Triton X-100 for a further 10 min at room temperature. After fixation, the cells were washed three times in phosphate buffer saline (PBS). Cells were then immediately immunostained.
Cell staining for immunofluorescence microscopy
Non-specific binding was blocked by incubating coverslips in blocking serum (diluted 1:60 in PBS) by using serum from the species in which the secondary antibody was raised (50, 51) for 10 min. 100 ml of primary antibodies against NFAT 4 was added to each coverslip and incubated at room temperature for 45 min. Cells were washed three times in PBS. Cells were then incubated with 100 ml of FITC-conjugated anti-rabbit and FITC-conjugated anti-goat secondary antibody for 45 min at room temperature. Cells were washed three times with Ca2+ and Mg2+-free PBS. Cells were then incubated with 50 mg/ml propidium iodide (PI) (Sigma Laboratories; Poole, UK) for 1 h at room temperature. Finally, cells were washed three times with Ca2+ and Mg2+-free PBS. Coverslips were mounted onto slides using vectorshield fluorescence mounting medium (Vector Laboratories Ltd; Peterborough, UK) and the edges sealed with clear nail varnish.
Counting of cells showing nuclear positivity
To assess the subcellular location quantitatively, counting was done in 4 fields of each coverslip using conventional fluorescence microscopy (Carl Zeiss, Germany) using a 60x objective lens. The numbers of cells showing positive nuclear staining were counted. In practice, at least 50 cells in 3 independent experiments (150 cells in total) were assessed at each time point.
Confocal microscopy
Cells were analysed using a Bio-Rad MRC 600 confocal laser scanning microscope (BioRad; Herts, UK), mounted on a Nikon Optiphot II (Nikon UK Ltd; Surrey, UK) upright stand with a Krypton/argon laser giving 448 nm, 568 nm, and 647 nm excitation lines. Suitable areas on the slide were located with X20 na 0.4 lens, and then imaged with a 60x na 1.4 oil immersion lens. Cells were imaged utilizing 488 nm lines (FITC, Oregon Green) and 568 nm lines (Alexa 568, PI) into Photo Multiplier Tube (PMT) channel 2 and 1 respectively. Excitation using the 488 and 568 laser lines independently was necessary to reduce some effects of ‘cross-talk’ between the fluorochromes due to the overlap of emission spectra and were gathered stack by stack. Z-series of approximately 10 to 15 optical sections (using 1 mm Z step) were then acquired and stored on a Panasonic optical drive (1GB), later transferred to a compact disc for analysis and archival using COMOS software (Bio-Rad, version 7.0). Independent Z series images were projected and composite images merged using Confocal Assistant software (version 4.2, Todd Clark Brelje). Later processed using Adobe PhotoShop (San Jose, CA, USA). In summary, Cells were fixed in 4% paraformaldehyde, permeabilised with 0.2% Triton X-100, incubated sequentially with rabbit-polyclonal anti-NFAT 4 antibody (1:500), goat anti-rabbit FITC (Sigma laboratories; Poole), UK, PI (50 mg/ml) and visualized using a Biorad confocal microscope.
Specificity of staining
Non-immune rabbit serum (Vector laboratories; Peterborough, UK) was included at equivalent concentrations as the primary antibodies in immunofluorescence studies as negative controls. In addition, equal dilution of secondary antibody was used with both the primary antibody and the negative control. Negative controls were scanned using the same settings (gain, black level and confocal aperture) as the positive control coverslips, thus ensuring that the pixel brightness values were due to antibody labeling rather than other factors such as autofluorescence or non-specific binding. Pixel brightness data were analyzed using COMOS software.
Reverse Transcrcription-Polymerase Chain Reaction
NFAT 4 cDNA sequences were obtained from GenBank at http://www.ncbi.nln.nih and complementary primers were designed to amplify target sequence specific for NFAT 4. Primers sequences were confirmed using the blast analysis at http://www.ncbi.nlm.nih.gov/blast. Coding sequence for NFAT 4 was aligned using Lasergene software (DNA Star Inc., Madison; USA) and primers were designed for each calcineurin subtype or NFAT isoform in areas of low homology. Primer set for human NFAT 4 was forward: 5’CTCGCGGCCTGCAGATCTTG 3’ and Backward: 5’GGCTCAAGAGGAAGATAGAG 3’, resulting in amplification 375 bp
Prevention of ribonuclease (RNases) contamination
RNases are particularly stable and thus difficult to destroy. A number of precautions were taken to avoid RNase contamination (52).
Isolation of RNA
Cultured keratinocytes and fibroblasts at approximately 70% confluence were washed twice with sterile Ca2+ and Mg2+-free PBS. Keratinocytes and fibroblasts were removed from flasks by treatment with 0.05% trypsin and 0.02% EDTA. Jurkat T cells (used as a positive control) grow in suspension and can be aspirated from flasks. Total RNA was isolated using RNeasy Mini Kit (QIAGEN; West Sussex, UK) according to manufacturer’s instruction.
Polymerase Chain Reaction (PCR)
3-5 ml of cDNA was amplified in 50 ml PCR reaction which consisted of 1.5 ml of 50 mM MgCl2 (Bioline; London, UK), 5 ml 10x NH4 buffer (Bioline; London, UK), 5 ml DMSO, 1.25 ml of 25 pmol forward primer, 1.25 ml of 25 pmol reverse primer and 4 ml of dNTP’s (2.5 mM each dNTP). Distilled water was added to make the total reaction volume equal 50 ml. Negative controls were included in each reaction by replacing the cDNA with water. 0.2 ml of 0.625 U BioTaqTM DNA polymerase (Bioline; London, UK) was added to the reaction after heating to 94°C for 5 min, followed by 34 cycles of denaturation at 94°C for 1 min, re-annealing at 55-57°C for 1 min and elongation at 72°C for 2 min. A final cycle of 72°C for 15 min was used. Similar cycle conditions were used for each set of primers.
Agarose Gel Electrophoresis
PCR products were electrophoresed through 1.5% agarose gels to determine product size. Loaded samples were visualized on a UVP transilluminator and photographed (Mitsubishi camera/ Polaroid black and white film type 667).
Gel extraction
PCR products were gel purified using a QIAGEN kit (QIAGEN; West Sussex, UK) to obtain single fragments for sequencing. DNA was separated using agarose gel electrophoresis. The appropriate band was excised weighed and sent for sequencing.
Sequencing of PCR products
Automated sequencing was carried out by MWG-Biotech AG (Ebersberg, Germany).
Western Blotting
Cells were lyzed in 2 X Sodium Dodecyl Sulphate (SDS), sample buffer (125 mM Tris-HCl, pH 6.8, 0.05% bromophenyl blue, 4% SDS, 20% glycerol and 10% β-mercaptoethanol). Equal amounts of samples and enhanced chemiluminescence molecular weight markers (Amersham, Bucks, UK) were electophoresed through 10% polyacrylamide gels, and Western Blotting were performed as described. (53), using anti-NFAT 4 (1:7500).
Immunohistochemistry:
Subjects and skin biopsies
Skin biopsies were obtained from normal volunteers and patients with psoriasis, following local ethical committee approval. Patients with psoriasis were excluded if they had received systemic anti-psoriatic, ultraviolet B (UVB), Psoralen and UVA (PUVA) or anti-inflammatory therapy during the last 3 months. Patients discontinued topical anti-psoriatic medication apart from emollients for two weeks prior to study. Following informed consent, paired 6 mm punch biopsies were obtained from the edge of psoriatic plaques (lesional) and non-lesional (uninvolved) skin on the lower back/buttock, under local anaesthesia and embedded in optimal cutting temperature (OCT) compound, frozen and stored at –70*C until required for study. Biopsies were obtained from five normal volunteers (3 males, 2 females, mean age 36 years) and a further five patients with stable plaque psoriasis (3 males, 2 females, mean age 54 years) for NFAT 4 studies.
Immunohistochemical analysis of skin biopsies
Five mm sections were cut on a cryostat (Bright; Huntingdon, England), placed on to APES-coated slides and fixed in ice-cold acetone for 15 min. Non-specific binding was blocked by incubating skin sections in blocking serum; (diluted 1:60 in PBS). This was done by using serum from the species in which the secondary antibody was raised (50, 51) for 20 min at room temperature. The sections were stained with anti-NFAT 4 rabbit polyclonal antibodies (1:500) in 0.1% BSA and in Ca2+ Mg2- free PBS for 1 h at the room temperature. Sections were developed using an avidin-biotin immunoperoxidase kit (Vector Laboratories, Peterborough, UK) using Ni2+ plus 3,3’-diaminobenzidine as the chromagen and counterstained with methyl green as described (54).
Assessment of immunohistochemical staining
The degree of staining was assessed on a semi-quantitative scale by the author but blinding was not possible due to characteristic morphological features of lesional psoriatic biopsies. The intensity of immunostaining was evaluated by using an ordinal 0-4 scale, where 0=no staining; 1= minimal; 2=minimal-moderate; 3=moderate and 4=maximal staining. Furthermore, localization (cytoplasmic versus nuclear) of each staining was examined in basal, suprabasal and high suprabasal layers in all stained sections as described (55).
Statistical analysis:
To compare the effects of specified treatment on the number of cells showing nuclear immunostaining, Chi square analysis was used. Data were analyzed using Arcus Quickstat software (Biomedical version 1.0).
Figure 2
Results
Expression of NFAT 4 mRNA in cultured keratinocytes and cultured fibroblasts
RT-PCR of keratinocyte and fibroblast cDNA, using NFAT 4 specific primers, produced the appropriate fragments size as predicted, demonstrating the presence of NFAT 4 mRNA in human epidermal keratinocytes and cultured dermal fibroblasts (Figure 2). Sequencing of RT-PCR products followed by BLAST analysis confirmed the identity of the products that show 100% homology with the predicted NFAT 4 (Accession# U85430) sequences. cDNA from Jurkat T cell mRNA was amplified as a positive control in these experiments.
Figure 3
Confirmation of expression of NFAT 4 in cultured keratinocytes and dermal fibroblasts by Western analysis
Western blotting showed that cultured human keratinocytes and dermal fibroblasts co-express NFAT 4 at the protein level (Figure 3). These experiments also demonstrated that the antibodies used in immunostaining experiments detected the appropriate molecular weight of NFAT 4 (~120 kDa). However, an additional band of (~66 kDa) was detected in lysates prepared from cultured keratinocytes and dermal fibroblasts. This band may reflect a degradation product of NFAT 4.
Optimization of fixation method for immunfluorescence studies of NFAT 4 and negative controls for immunostaining studies
Different fixatives (see Materials and Methods) were included in studying the subcellular localization of NFAT 4. Different fixatives did not result in any significant differences in the distribution of NFAT 4 in cultured human keratinocytes (Data not shown). 0.4% paraformaldehyde followed by permeabilisation with 0.2% Triton X-100 was used in subsequent experiments. Non-immune rabbit serum, at a similar dilution to the primary antibody, was included in the immunostaining protocol as a negative control. No significant staining was detected with the non-immune in both immunofluorescence and immunohistochemical studies. For immunofluorescence studies cells were visualised by immunofluorescence and confocal microscopy using the same settings for each experiment as described in Materials and Methods.
Figure 4
NFAT 4 is co-expressed in normal and psoriatic skin in vivo
Immunohistochemical studies of normal human and psoriatic skin showed prominent expression of NFAT 4 (Figure 4) in epidermal keratinocytes together with expression in dermal fibroblasts. NFAT 4 immunostaining were also observed in skin appendages in normal and psoriatic skin and within the dermal inflammatory cell infiltrate in psoriasis. NFAT 4 appeared to be expressed by melanocytes in normal skin (Figure 4). Cytoplasmic and membrane patterns of NFAT 4 expression were observed in keratinocytes (Figure 4). No consistent differences were observed between normal skin, lesional or non-lesional psoriatic skin with respect to NFAT 4 localization (Table 1).
Table 1 Distribution of NFAT 4 in normal (A) and psoriatic (B) skin.
A Normal Skin
|
|
Basal |
Suprabasal |
High suprabasal |
|
Subject 1 |
3 C |
3 C |
3 C |
|
Subject 2 |
2 C |
2 C |
2 C |
|
Subject 3 |
3 C |
2 C |
2 C |
|
Subject 4 |
3 C |
3 C |
3 C |
|
Subject 5 |
2 C |
2 C |
1 C |
(B) Psoriatic skin
|
|
Skin type |
Basal |
Suprabasal |
High suprabasal |
|
Subject 1 |
Lesional |
4 C |
2 C |
3 C |
|
Non-lesional |
4 C |
4 C |
4 C |
|
|
Subject 2 |
Lesional |
3 C |
3 C |
3 C |
|
Non-lesional |
3 C |
3 C |
3 C |
|
|
Subject 3 |
Lesional |
2 C |
1 C |
1 C |
|
Non-lesional |
3 C |
2 C |
2 C |
|
|
Subject 4 |
Lesional |
3 C |
3 C |
3 C |
|
Non-lesional |
3 C |
3 N/C |
3 C |
|
|
Subject 5 |
Lesional |
2 C |
3 C |
2 C |
|
Non-lesional |
3 C |
3 C |
3 C |
The intensity of immunostaining was evaluated by using an ordinal 0-4 scale, where 0= no staining; 1= minimal; 2=minimal-moderate; 3= moderate and 4=maximal staining. N indicates that the staining was predominantly nuclear, C indicates predominantly cytoplasmic and N/C indicates an equal distribution between the two compartments.
Please click here to view complete article